v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-19a-3p URS000006FDD4_10090

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUGCAAAUCUAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-19-P1a_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-19-P1a_3p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-19a
  4. Bos taurus bta-miR-19a
  5. Callithrix jacchus cja-miR-19a
  6. Callorhinchus milii Cmi-Mir-19-P1a-v1_3p (mature (guide))
  7. Canis lupus familiaris cfa-miR-19a
  8. Capra hircus chi-miR-19a
  9. Cavia porcellus (domestic guinea pig) cpo-miR-19a-3p
  10. Cervus elaphus cel-miR-19a
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P1a_3p (mature (guide))
  12. Columba livia cli-miR-19a-3p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-19a
  14. Danio rerio dre-miR-19a-3p
  15. Dasypus novemcinctus dno-miR-19a-3p
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-19-P1a_3p (mature (guide))
  17. Equus caballus (horse) eca-miR-19a
  18. Gadus morhua (Atlantic cod) gmo-miR-19a-3p
  19. Gallus gallus (chicken) gga-miR-19a-3p
  20. Gekko japonicus Gja-Mir-19-P1a_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-19a (MIR19A)
  22. Gorilla gorilla ggo-miR-19a
  23. Homo sapiens (human) hsa-miR-19a-3p
  24. Lagothrix lagotricha (brown woolly monkey) lla-miR-19a
  25. Latimeria chalumnae Lch-Mir-19-P1a_3p (mature (guide))
  26. Lemur catta (Ring-tailed lemur) lca-miR-19a
  27. Macaca mulatta mml-miR-19a-3p
  28. Macaca nemestrina (pig-tailed macaque) mne-miR-19a
  29. Microcaecilia unicolor Mun-Mir-19-P1a_3p (mature (guide))
  30. Monodelphis domestica (gray short-tailed opossum) mdo-miR-19a-3p
  31. Monopterus albus Mal-Mir-19-P1a2_3p (mature (guide))
  32. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-19a
  33. Ophiophagus hannah oha-miR-19a-3p
  34. Ornithorhynchus anatinus oan-miR-19a-3p
  35. Oryctolagus cuniculus (rabbit) ocu-miR-19a-3p
  36. Ovis aries (sheep) miscellaneous RNA
  37. Pan paniscus (pygmy chimpanzee) ppa-miR-19a
  38. Pan troglodytes (chimpanzee) ptr-miR-19a
  39. Pongo pygmaeus (Bornean orangutan) ppy-miR-19a
  40. Python bivittatus pbv-miR-19a-3p
  41. Rattus norvegicus (Norway rat) rno-miR-19a-3p
  42. Saguinus labiatus (red-chested mustached tamarin) sla-miR-19a
  43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-19-P1a_3p (mature (guide))
  44. Scyliorhinus torazame Sto-Mir-19-P1a-v1_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-19-P1a_3p (mature (guide))
  46. Sus scrofa (pig) ssc-miR-19a
  47. Takifugu rubripes (torafugu) fru-miR-19a
  48. Tetraodon nigroviridis tni-miR-19a
  49. Tor tambroides miR-19a-3p
  50. Tupaia chinensis tch-miR-19a-3p
  51. Xenopus laevis (African clawed frog) Xla-Mir-19-P1a4_3p (mature (co-guide))
  52. Xenopus tropicalis xtr-miR-19a
 Publications