Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-144-5p URS000004F117_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-144: Mmu-mir-144 is a microRNA that has been studied in various contexts. In the skeletal muscle of old rhesus monkeys, the expression of mmu-mir-144 is increased, but this expression is reversed by caloric restriction (CR) [PMC5559175]. In CD34+SCA1+ BMHSCs, mmu-mir-144 is down-regulated after CTX treatment, and its up-regulation by SHSB granule enhances BMHSCs proliferation [PMC5617494]. The role of mmu-mir-144 in the proliferation or differentiation of hematopoietic stem cells is not well understood [PMC5617494]. SHSB granule also down-regulates mmu-mir-142-3p, mmu-miR-210, and mmu-miR-223 in CD34+SCA1+ BMHSCs [PMC5617494]. Mmu-mir-144 has been found to be downregulated after inducing CCI and its target gene Rasa1 increases proinflammatory mediators after CCI [PMC8914318]. In the bone marrow, the short isoform of Bzw1 is co-expressed with mmu-mir-142a, while the brain-specific long isoform contains two binding sites for mmu-mir-144 [PMC9226526]. Mmu-miR-342, mmu-miR-206, and mmu-mir-144 are associated with NF-gamma and joint target genes [PMC7074395]. Mmu-miR135a and seven other microRNAs including mmu mir 144 are associated with DEGs-related transcription factors after ovariectomy or orchiectomy [PMC7074395]. Mmu mir 342 has not been studied in mouse thymus but deserves further investigation along with other microRNAs [PMC7074395]. Mmu-mir-144 is predicted by Sylamer and CORNA and GeneSet2MiRNA [PMC6086043].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAUAUCAUCAUAUACUGUAAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Publications