Homo sapiens (human) VPS9D1 antisense RNA 1 (VPS9D1-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) VPS9D1 antisense RNA 1 (VPS9D1-AS1) URS000003F392_9606

1,753 nucleotides
8 databases (Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, MalaCards, NONCODE, RefSeq)
Found in 0 other species
139 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

VPS9D1-AS1: VPS9D1-AS1 is a long non-coding RNA (lncRNA) that was quantitated in non-small cell lung cancer (NSCLC) tumors and cell lines in a study [PMC6977701]. The study also selected three lncRNAs, including CASC8, LINC01842, and VPS9D1-AS1, and confirmed their overexpression using quantitative real-time polymerase chain reaction (qRT-PCR) [PMC6842565]. VPS9D1-AS1 is a type of lncRNA that has been investigated in the context of NSCLC. The study quantitated the expression of VPS9D1-AS1 in NSCLC tumors and cell lines [PMC6977701]. Additionally, the study selected three lncRNAs, including VPS9D1-AS1, and confirmed their overexpression using qRT-PCR [PMC6842565].

Targeting miRNAs 26 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAAGCCUGGGCCCGUGGGGGACGCACAUGGUCCUGUUCGUACUCCAGGAUGGCGGCGUAAAGGGCCCGCUGCUCCCGUUCCUCCGGGGUCAGGGCGACUUGGCUGCAAAACCUCCUGGGGAGAAAGGCACGCGGUGGGUGCCGGGGCCAGGCCCUCCCCGCAGCGGCCCCAGGGGCGGGCAGGAGUCCCACCUGUUGGCGGCCUCCUGGAGCCGCAGCCGGCGCUCCUCCAUCUUUCUCUGGAGCUGGGUGCAGAGUCAAGGGGCCGAGCGUGGGAUCUGAGCGGGCCCUCGGUUCCCAACCCCGUCCCACACCCGGAGAGGCCGGGACGUCCCAGGGACCUCCUCUCGGUGAGGGGCUGUCCCCAGGGAGGCCUCCUCCAGUGGCGUCAGCUCUCUGGAAAUGUGACAAGCUGCUGUCUAGACCCCAGGAAGCCCAGUGGUGUCUGGACACCAGAGGAGUCUCUCUCAUCCUCCCGGAUUGCUCUGAGGCCAGGAGCUUUGUGACUCUGCCCCCUGAAGCUUCUGGAAGAUCUCGGGUGGCAGAAAAGGAGAGAGCUUUCCUCCUUCAUCGGAGUAUACACGGCGGUGUCGGCCGGCAGGCUGGGGAAUGGGAGCAGCUGCAGGCAUGGUUGGCUUCAGGCGUGUUUUCCCUGCAAGCCAUGGGUAACCAGGGGUCAAGCGGUGGGCCACAUCCCACAGAGGAGAUGCGGGCUUGGGGGAUGCCCCAGGAGAGCCGCCUACUGCAGGAGACCCACCAAGCUUGGCGGCCGUCGACUGGGCCCUCUCCAGACACUGCUGUGCUAGCUUCAGCAUCUUGGAGGUGUCGGGGGGCACAGUUUCCCCAGCUUCUGGGGGAGGGACAAGAAGGCUGGUCACAGUCGGCUCUACCACUGUUACUUACUGCUGAGAUAAAAUGAGGCAACGGAAAAGGCCUCUGGGAAGUGGCCGUUUUACAGAGACAAGGACGUGCUGAGGGGAUCGCCUCACCCAUCUCCCACCGGCUGUGUCCCCAAAGUCCUGCCUUCCCGUAGCUUGGCAUGGAGCACCUCUGCGCGACCAUGGACCUGCUCACACAGCCCUUCUGCGCGCCGUGGGAGCUGCCUCUCUGUGACUCGCCCCUGGACCCACCGCCCCAGCGCCUGACCCACCUCCCUGCUGCCCUUCACAGAAAACUUCUCAUAGACUCCCAUUUUCUCAUCCCGCCCCGAUUUAGCCCCCGACUCCCCCCGGAAACUGCCCUUACCCGUCCCCACCUUGCCAGACACGGUGGGCCACUGGAGUUCCUCUGUCUUCUGGGACUUUGCUCUCCCCAGGGGAUCCUCUGCCACUCCUCCACCCAACUCCUCAAUCUUGGAGCGCCAGAGCUCAGCCGAGCUCACCGGCUCCCUAGGGAGCUGGGGCAACUGUUAGCUCCCCCUGACCUGUGUGAUCCUACGUCCAGUGGCUGCCCCGACCUCUGUGAUCCCACGUCCAGGGGCUCCCCCGACCUCUGUGAUCCCACGUCCAGUGGCUCCCCCGACCUCUGUGCUCCCACGUCCAGUGGCUCCCCCGACCUCUGUGCUCCCACGUCCAGUGGCUCCCCCGACCUCUGUGCUCCCACGUCCAGUGGGUCCCCCUGACCUCUGUGAUCCCACGUCCAGUGGCUCCCCCUGACCUCUGUGCUCUAUGUCCAGUGGCUCCCCCUGACCUCUGUGAUCCUUUGUGCAGCGGCUGCUGGCCUCUCAAACUUAAUGUGUUCAUUGCGGAACUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications