Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-5690 URS000075B186_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-5690: Hsa-mir-5690 is a microRNA that has been studied in the context of chondrogenesis and osteogenic differentiation. In a set of samples, the differential expression of hsa-mir-5690 was not confirmed, as it was mostly undetectable [PMC7072123]. However, in osteogenic differentiation, the overexpression of hsa-mir-5690 was confirmed [PMC7072123]. Reverse transcription and qPCR were performed using specific assays for hsa-mir-5690 [PMC7072123]. A 16-miRNA signature, which includes hsa-mir-5690, showed a similar ability to classify lung adenocarcinoma (LUAD) pathological stages as combinations of 42 or 26 miRNAs [PMC7138293]. Among a list of 27 differentially expressed miRNAs, hsa-mir-5690 showed a high degree in the network analysis [PMC8903000]. Upstream non-coding RNAs that might regulate RPL6 expression were not investigated in this study. However, hsa_mir-5690 was one of the non-coding RNAs analyzed from TargetScan [PMC8902122]. References: [PMC7072123] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7072123/ [PMC7138293] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7138293/ [PMC8903000] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8903000/ [PMC8902122] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8902122/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGCUACUACCUCUAUUAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Macaca fascicularis microRNA miR-5690-5p
Publications