Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1269b URS000015CE89_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1269b: Hsa-mir-1269b is a differentially expressed miRNA that has been identified in various studies. It is upregulated in hepatocellular carcinoma (HCC) [PMC8357504] and promotes malignancy in HCC by upregulating cell division cycle 40 homolog [PMC7150540]. Hsa-mir-1269b has also been found to be downregulated in basal cell carcinoma and gastric cancer [PMC8907717]. It is a member of the miR-1269 family, along with hsa-mir-1269a [PMC8894702]. Hsa-mir-1269b has been shown to have the largest percentage of edited bases in the normal control group [PMC3868500]. It has also been identified as a prognostic factor impacting the survival of HCC patients [PMC7150540]. However, there is a lack of detection methods for hsa-mir-1269b, which may explain the limited research on this miRNA [PMC8894702]. In addition, hsa-mir-1269b has been found to be dysregulated in tongue cancer and non-small cell lung cancer (NSCLC) [PMC8894079] [PMC8918330]. Notably, hsa-mir-1269b, along with hsa-miR-525-5p and hsa-miR-526b-5p, have only been recognized in disease conditions [PMC7926632]. Overall, hsa-mir-1269b plays a role in various cancers and may have potential as a prognostic factor. However, further research is needed to fully understand its functions and develop effective detection methods for this miRNA.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGACUGAGCCAUGCUACUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications