Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR408-3p URS000003D781_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR408-3p: Osa-mir408-3p is a microRNA that has been identified in rice plants and has been found to be highly expressed in various tissues and under different abiotic stresses [PMC7526420]. It has been shown to be downregulated during chilling stress in rice plants, which may lead to oxidative damage and impair the photosynthetic process [PMC9002458]. Osa-mir408-3p is known to target the gene OsPYL6 and is involved in cell elongation in rice seeds [PMC10116700]. It has also been found to be differentially expressed in heat-tolerant genotypes, suggesting a potential role in the recovery response [PMC5447883]. Osa-mir408-3p has been shown to be involved in disease resistance mechanisms, as its downregulation was observed during infection with R. solani [PMC9189367]. Additionally, it has been found to be upregulated during tiller development and involved in abiotic stress responses [PMC7539525]. Osa-mir408-3p is also upregulated under cadmium stress and may play a role in Cd accumulation [PMC7003353]. Overall, osa-mir408-3p appears to have diverse functions and plays a role in various physiological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCACUGCCUCUUCCCUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Brachypodium distachyon bdi-miR408-3p
  2. Carica papaya cpa-miR408
  3. Digitalis purpurea (common foxglove) dpr-miR408
  4. Oryza sativa Indica Group miR408
  5. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR408-3p
  6. Ricinus communis (castor bean) rco-miR408
  7. Saccharum officinarum (sugarcane) sof-miR408a
  8. Saccharum sp. ssp-miR408a
  9. Sorghum bicolor (sorghum) sbi-miR408
  10. Triticum aestivum tae-miR408
  11. Zea mays (maize) zma-miR408a
Publications