v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR408-3p URS000003D781_39947

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGCACUGCCUCUUCCCUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Brachypodium distachyon bdi-miR408-3p
  2. Carica papaya cpa-miR408
  3. Digitalis purpurea (common foxglove) dpr-miR408
  4. Oryza sativa (Asian cultivated rice) osa-miR408-3p
  5. Oryza sativa Indica Group miR408
  6. Ricinus communis (castor bean) rco-miR408
  7. Saccharum officinarum (sugarcane) sof-miR408a
  8. Saccharum sp. ssp-miR408a
  9. Sorghum bicolor (sorghum) sbi-miR408
  10. Triticum aestivum tae-miR408
  11. Zea mays (maize) zma-miR408a