Brachypodium distachyon (stiff brome) bdi-miR408-3p URS000003D781_15368

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 11 other species
• 735 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

CUGCACUGCCUCUUCCCUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

1. Carica papaya cpa-miR408
2. Digitalis purpurea (common foxglove) dpr-miR408
3. Oryza sativa (Asian cultivated rice) osa-miR408-3p
4. Oryza sativa Indica Group miR408
5. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR408-3p
6. Ricinus communis (castor bean) rco-miR408
7. Saccharum officinarum (sugarcane) sof-miR408a
8. Saccharum sp. ssp-miR408a
9. Sorghum bicolor (sorghum) sbi-miR408
10. Triticum aestivum tae-miR408
11. Zea mays (maize) zma-miR408a

Publications Download

• FASTA
• JSON