Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brachypodium distachyon (stiff brome) bdi-miR408-3p URS000003D781_15368

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Brachypodium distachyon. Annotated by 2 databases (RefSeq, miRBase). Brachypodium distachyon (stiff brome) bdi-miR408-3p sequence is a product of bdi-miR408, miR408-3p, bdi-miR408-3p, miR408, MIR408 genes. Found in the Brachypodium distachyon reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CUGCACUGCCUCUUCCCUGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Carica papaya cpa-miR408
    2. Digitalis purpurea dpr-miR408
    3. Oryza sativa Indica Group miR408
    4. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR408-3p
    5. Oryza sativa osa-miR408-3p
    6. Ricinus communis rco-miR408
    7. Saccharum officinarum sof-miR408c
    8. Saccharum sp. ssp-miR408d
    9. Sorghum bicolor sbi-miR408
    10. Triticum aestivum tae-miR408
    11. Zea mays zma-miR408a
    Publications