Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-496-3p URS000003BF62_9986

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Oryctolagus cuniculus. Annotated by 3 databases (RefSeq, miRBase, MirGeneDB). Described in 3 papers. Oryctolagus cuniculus (rabbit) ocu-miR-496-3p sequence is a product of miR-496-3p, miR-496, MIR496, ocu-miR-496-3p, ocu-miR-496 genes. Found in the rabbit reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGUAUUACAUGGCCAAUCUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 23 other species

    1. Bos taurus (cattle) bta-miR-496
    2. Canis lupus familiaris cfa-miR-496
    3. Cavia porcellus (domestic guinea pig) cpo-miR-496-3p
    4. Cervus elaphus (red deer) Cel-miR-496
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-496-3p
    6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P20-v1_3p (mature (guide))
    7. Equus caballus (horse) eca-miR-496
    8. Homo sapiens hsa-miR-496
    9. Macaca mulatta mml-miR-496
    10. Mus musculus (house mouse) mmu-miR-496a-3p
    11. Pan troglodytes (chimpanzee) ptr-miR-496
    12. Pongo pygmaeus ppy-miR-496
    13. Rattus norvegicus Rno-Mir-154-P20-v1_3p (mature (guide))
    14. Sus scrofa ssc-mir304