v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P20-v1_3p (mature (guide)) URS000003BF62_9371

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGUAUUACAUGGCCAAUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus (cattle) bta-miR-496
  2. Canis lupus familiaris cfa-miR-496
  3. Cavia porcellus (domestic guinea pig) cpo-miR-496-3p
  4. Cervus elaphus (red deer) Cel-miR-496
  5. Dasypus novemcinctus dno-miR-496-3p
  6. Equus caballus (horse) eca-miR-496
  7. Homo sapiens (human) hsa-miR-496
  8. Macaca mulatta (Rhesus monkey) mml-miR-496
  9. Mus musculus mmu-miR-496a-3p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-496-3p
  11. Pan troglodytes ptr-miR-496
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-496
  13. Rattus norvegicus (Norway rat) Rno-Mir-154-P20-v1_3p (mature (guide))
  14. Sus scrofa (pig) ssc-mir304