Pongo pygmaeus (Bornean orangutan) ppy-miR-496

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-496 URS000003BF62_9600

22 nucleotides
1 database (miRBase)
Found in 14 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGAGUAUUACAUGGCCAAUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

Bos taurus (cattle) bta-miR-496
Canis lupus familiaris cfa-miR-496
Cavia porcellus (domestic guinea pig) cpo-miR-496-3p
Cervus elaphus (red deer) Cel-miR-496
Dasypus novemcinctus dno-miR-496-3p
Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P20-v1_3p (mature (guide))
Equus caballus (horse) eca-miR-496
Homo sapiens (human) hsa-miR-496
Macaca mulatta (Rhesus monkey) mml-miR-496
Mus musculus mmu-miR-496a-3p
Oryctolagus cuniculus (rabbit) ocu-miR-496-3p
Pan troglodytes ptr-miR-496
Rattus norvegicus (Norway rat) Rno-Mir-154-P20-v1_3p (mature (guide))
Sus scrofa (pig) ssc-mir304