Pan troglodytes (chimpanzee) ptr-miR-496 URS000003BF62_9598

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 14 other species
• 6 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGAGUAUUACAUGGCCAAUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

1. Bos taurus (cattle) bta-miR-496
2. Canis lupus familiaris cfa-miR-496
3. Cavia porcellus (domestic guinea pig) cpo-miR-496-3p
4. Cervus elaphus (red deer) Cel-miR-496
5. Dasypus novemcinctus dno-miR-496-3p
6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P20-v1_3p (mature (guide))
7. Equus caballus (horse) eca-miR-496
8. Homo sapiens (human) hsa-miR-496
9. Macaca mulatta (Rhesus monkey) mml-miR-496
10. Mus musculus mmu-miR-496a-3p
11. Oryctolagus cuniculus (rabbit) ocu-miR-496-3p
12. Pongo pygmaeus (Bornean orangutan) ppy-miR-496
13. Rattus norvegicus (Norway rat) Rno-Mir-154-P20-v1_3p (mature (guide))
14. Sus scrofa (pig) ssc-mir304

Publications Download

• FASTA
• JSON