Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-496 URS000003BF62_9544

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Macaca mulatta. Annotated by 2 databases (RefSeq, miRBase). Macaca mulatta (Rhesus monkey) mml-miR-496 sequence is a product of mml-miR-496, MIR496, miR-496 genes. Found in the Macaca mulatta reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGUAUUACAUGGCCAAUCUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Bos taurus bta-miR-496
    2. Canis lupus familiaris cfa-miR-496
    3. Cavia porcellus (domestic guinea pig) cpo-miR-496-3p
    4. Cervus elaphus Cel-miR-496
    5. Dasypus novemcinctus dno-miR-496-3p
    6. Echinops telfairi Ete-Mir-154-P20-v1_3p (mature (guide))
    7. Equus caballus (horse) eca-miR-496
    8. Homo sapiens hsa-miR-496
    9. Mus musculus mmu-miR-496a-3p
    10. Oryctolagus cuniculus (rabbit) ocu-miR-496-3p
    11. Pan troglodytes (chimpanzee) ptr-miR-496
    12. Pongo pygmaeus (Bornean orangutan) ppy-miR-496
    13. Rattus norvegicus (Norway rat) Rno-Mir-154-P20-v1_3p (mature (guide))
    14. Sus scrofa (pig) ssc-mir304
    Publications