Tribolium castaneum (red flour beetle) tca-miR-970-3p URS00000384A0_7070

• 21 nucleotides
• 3 databases (ENA, miRBase, RefSeq)
• Found in 14 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UCAUAAGACACACGCGGCUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

1. Aedes aegypti aae-miR-970
2. Anopheles gambiae (African malaria mosquito) aga-miR-970
3. Bactrocera dorsalis bdo-miR-970
4. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-970
5. Cochliomyia macellaria mature cma-miR-970
6. Culex quinquefasciatus cqu-miR-970
7. Drosophila ananassae Dan-Mir-970_3p (mature (guide))
8. Drosophila melanogaster (fruit fly) dme-miR-970-3p
9. Drosophila mojavensis Dmo-Mir-970_3p (mature (guide))
10. Drosophila pseudoobscura dps-miR-970-3p
11. Drosophila pseudoobscura pseudoobscura miRNA FBtr0331101_df_nrg
12. Drosophila simulans dsi-miR-970-3p
13. Drosophila virilis dvi-miR-970-3p
14. Drosophila yakuba Dya-Mir-970_3p (mature (guide))

Download

• FASTA
• JSON