Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tribolium castaneum (red flour beetle) tca-miR-970-3p URS00000384A0_7070

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Tribolium castaneum. Annotated by 3 databases (RefSeq, ENA, miRBase). Described in 4 papers. Tribolium castaneum (red flour beetle) tca-miR-970-3p sequence is a product of tca-miR-970-3p, tca-miR-970, Mir970, miR-970-3p, miR-970 genes. Found in the red flour beetle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCAUAAGACACACGCGGCUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-970
    2. Anopheles gambiae (African malaria mosquito) aga-miR-970
    3. Bactrocera dorsalis bdo-miR-970
    4. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-970
    5. Cochliomyia macellaria mature cma-miR-970
    6. Culex quinquefasciatus (southern house mosquito) cqu-miR-970
    7. Dasypus novemcinctus Dan-Mir-970_3p (mature (guide))
    8. Drosophila melanogaster (fruit fly) dme-miR-970-3p
    9. Drosophila mojavensis Dmo-Mir-970_3p (mature (guide))
    10. Drosophila pseudoobscura dps-miR-970-3p
    11. Drosophila pseudoobscura pseudoobscura miRNA FBtr0331101_df_nrg
    12. Drosophila simulans dsi-miR-970-3p
    13. Drosophila virilis dvi-miR-970-3p