Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
TRNASER from Thermus thermophilus (PDB 1SER, chain T) secondary structure diagram

TRNASER from Thermus thermophilus (PDB 1SER, chain T) URS00000337BF_274

Automated summary: This tRNA sequence is 94 nucleotides long and is found in Thermus thermophilus. Annotated by 2 databases (PDBe, ENA). Described in 3 papers. Has a conserved secondary structure or a structured region. Has an experimentally determined 3D structure. Matches 1 Rfam family (tRNA, RF00005).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGAGAGGUGCCCGAGUGGCUGAAGGGACACGACUGGAAAUCGUGUAGGGGGGCUUAAACCUCCCUCGCGGGUUCGAAUCCCGCCCUCUCCGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 7 other species

    1. Thermus parvatiensis tRNA-Ser
    2. Thermus sp. tRNA-Ser
    3. Thermus thermophilus HB27 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
    4. Thermus thermophilus HB8 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
    5. Thermus thermophilus JL-18 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
    6. Thermus thermophilus SG0.5JP17-16 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
    2D structure Publications New