Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Thermus parvatiensis tRNA-Ser secondary structure diagram

Thermus parvatiensis tRNA-Ser URS00000337BF_456163

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAGAGGUGCCCGAGUGGCUGAAGGGACACGACUGGAAAUCGUGUAGGGGGGCUUAAACCUCCCUCGCGGGUUCGAAUCCCGCCCUCUCCGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Idiomarina sp. Sol25 tRNA-Ser
  2. Thermus sp. tRNA-Ser
  3. Thermus thermophilus HB27 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
  4. Thermus thermophilus HB8 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
  5. Thermus thermophilus JL-18 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
  6. Thermus thermophilus SG0.5JP17-16 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
  7. Thermus thermophilus TRNASER from Thermus thermophilus (PDB 1SER, chain T)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...