Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
TRNASER from Thermus thermophilus (PDB 1SER, chain T) secondary structure diagram

TRNASER from Thermus thermophilus (PDB 1SER, chain T) URS00000337BF_274

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAGAGGUGCCCGAGUGGCUGAAGGGACACGACUGGAAAUCGUGUAGGGGGGCUUAAACCUCCCUCGCGGGUUCGAAUCCCGCCCUCUCCGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Idiomarina sp. Sol25 tRNA-Ser
  2. Thermus parvatiensis tRNA-Ser
  3. Thermus sp. (metagenome) tRNA-Ser
  4. Thermus thermophilus HB27 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
  5. Thermus thermophilus HB8 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
  6. Thermus thermophilus JL-18 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
  7. Thermus thermophilus SG0.5JP17-16 tRNA-Ser (GGA) (tRNA-Ser-GGA-1-1)
2D structure Publications