Automated summary: This miRNA sequence is 23 nucleotides long and is found in Drosophila melanogaster. Annotated by 5 databases (PirBase, ENA, RefSeq, miRBase, FlyBase). Drosophila melanogaster (fruit fly) dme-miR-305-5p sequence is a product of dme-miR-305, 305-R, dme-miR-305-5p, FBgn0262458, miR-305-5p, mir-305-RA, 305-RA, miR-305, mir-305 genes. Found in the Drosophila melanogaster reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AUUGUACUUCAUCAGGUGCUCUG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.