Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nasonia longicornis nlo-miR-305 URS0000025D76_7427

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUGUACUUCAUCAGGUGCUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Anopheles gambiae aga-miR-305
  2. Apis mellifera ame-miR-305-5p
  3. Bombyx mori (domestic silkworm) bmo-miR-305-5p
  4. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-305-5p
  5. Cochliomyia macellaria mature cma-miR-305-5p
  6. Drosophila ananassae dan-miR-305
  7. Drosophila erecta der-miR-305
  8. Drosophila grimshawi dgr-miR-305
  9. Drosophila melanogaster (fruit fly) dme-miR-305-5p
  10. Drosophila mojavensis dmo-miR-305
  11. Drosophila persimilis dpe-miR-305
  12. Drosophila pseudoobscura dps-miR-305
  13. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294449_df_nrg
  14. Drosophila sechellia dse-miR-305
  15. Drosophila simulans miRNA FBtr0296028_df_nrg
  16. Drosophila willistoni dwi-miR-305
  17. Drosophila yakuba dya-miR-305
  18. Nasonia giraulti ngi-miR-305
  19. Nasonia vitripennis nvi-miR-305