Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-305-5p URS0000025D76_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-305: Bmo-mir-305 is a microRNA (miRNA) that has been identified in a study on miRNAs in the posterior silk gland (PSG) [PMC7859555]. This study predicted that bmo-mir-305 can simultaneously target FibL and SGF1, while bmo-mir-3334 can target FibH [PMC7859555]. In the anterior-middle and posterior silk gland, the read counts of bmo-miR-275 are almost 10-fold greater than those of bmo-mir-305, but only two-fold greater relative to the whole body [PMC2838851]. Bmo-miR-275 and bmo-mir-305 belong to different miRNA families, mir-275 and mir-305 [PMC2435238]. Contrary results were found among various miRNAs, including bmo-mir-305, where literature-based collections showed higher expression levels [PMC4045974]. There are exceptional cases where miRNAs are less abundant than their corresponding miRNA* counterparts, including bmo-miR-10, bmo-miR-276, bmo-mir-305, bmo-miR33, and bmo-miR34 [PMC4045974]. The expression level of bmo-miR2758 was higher than that of either bmo-miR2b* orb mo mir 305 under the same template concentration [PMC4801057]. However, sequencing results revealed that only three candidates were in accordance with those in the database records: BMO-MIR2B*, BMO-MIR 305 and BMO-MIR2758[PMC4801057].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUGUACUUCAUCAGGUGCUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Anopheles gambiae aga-miR-305
  2. Apis mellifera ame-miR-305-5p
  3. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-305-5p
  4. Cochliomyia macellaria mature cma-miR-305-5p
  5. Drosophila ananassae dan-miR-305
  6. Drosophila erecta der-miR-305
  7. Drosophila grimshawi dgr-miR-305
  8. Drosophila melanogaster (fruit fly) dme-miR-305-5p
  9. Drosophila mojavensis dmo-miR-305
  10. Drosophila persimilis dpe-miR-305
  11. Drosophila pseudoobscura dps-miR-305
  12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294449_df_nrg
  13. Drosophila sechellia dse-miR-305
  14. Drosophila simulans miRNA FBtr0296028_df_nrg
  15. Drosophila willistoni dwi-miR-305
  16. Drosophila yakuba dya-miR-305
  17. Nasonia giraulti ngi-miR-305
  18. Nasonia longicornis nlo-miR-305
  19. Nasonia vitripennis nvi-miR-305
Publications