Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-338 URS00000254A6_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-338: Ssc-mir-338 is a microRNA that plays a role in inflammatory signaling and muscle development [PMC7333078] [PMC6737989]. The inhibition of ssc-mir-338 expression by lipopolysaccharide (LPS) was not affected by adrenocorticotropic hormone (ACTH) pretreatment, indicating that ACTH does not influence the LPS-induced inhibition of ssc-mir-338 [PMC7333078]. However, there was an ACTH × LPS effect on the expression level of ssc-mir-338, suggesting a potential interaction between ACTH and LPS in regulating ssc-mir-338 expression [PMC7333078]. The decrease in ssc-mir-338 level induced by LPS was not affected by ACTH pretreatment, suggesting that other inflammatory molecules may be targeted by the ACTH-stimulated miR-146 or ssc-mir-338 regulatory circuit [PMC7333078]. In a pig model, LPS injection alone significantly decreased the level of ssc-mir-338 [PMC7333078]. Additionally, four miRNAs, including ssc-miR-151-3p and ssc-miR-532-5p precursors, did not map to any chromosome in the available database but were paired with muscle-associated miRNAs such as ssc-miR133a3p and ssc-mir338 [PMC3579806] [PMC6737989]. These interaction pairs included several miRNAs known to have important roles in myogenesis [PMC6737989]. Overall, these findings suggest that ACTH pretreatment attenuates LPS-induced inflammation and mitochondria damage but does not affect the inhibition of sccmir338 or inducible nitric oxide synthase secretion induced by LPS [PMC7333078].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAGCAUCAGUGAUUUUGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Alligator mississippiensis ami-miR-338-3p
  2. Callorhinchus milii eshark_mir-338_1
  3. Cyprinus carpio (common carp) ccr-miR-338
  4. Danio rerio dre-miR-338
  5. Equus caballus (horse) eca-miR-338-3p
  6. Gadus morhua gmo-miR-338-3p
  7. Haplochromis burtoni abu-miR-338
  8. Homo sapiens (human) hsa-miR-338-3p
  9. Ictalurus punctatus ipu-miR-338
  10. Macaca mulatta mml-miR-338-3p
  11. Maylandia zebra mze-miR-338
  12. Mus musculus (house mouse) mmu-miR-338-3p
  13. Neolamprologus brichardi (lyretail cichlid) nbr-miR-338
  14. Oreochromis niloticus oni-miR-338
  15. Pan troglodytes (chimpanzee) ptr-miR-338
  16. Pongo pygmaeus (Bornean orangutan) ppy-miR-338-3p
  17. Pundamilia nyererei pny-miR-338
  18. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63002
  19. Salmo salar (Atlantic salmon) ssa-miR-338a-3p
  20. Sarcophilus harrisii sha-miR-338
  21. Taeniopygia guttata tgu-miR-338-3p
  22. Takifugu rubripes fru-miR-338
  23. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-338
  24. Tor tambroides miR-338
  25. Xenopus laevis (African clawed frog) xla-miR-338
  26. Xenopus tropicalis (tropical clawed frog) xtr-miR-338
Publications