Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Haplochromis burtoni (Burton's mouthbrooder) abu-miR-338 URS00000254A6_8153

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAGCAUCAGUGAUUUUGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Alligator mississippiensis ami-miR-338-3p
  2. Callorhinchus milii eshark_mir-338_1
  3. Cyprinus carpio (common carp) ccr-miR-338
  4. Danio rerio dre-miR-338
  5. Equus caballus (horse) eca-miR-338-3p
  6. Gadus morhua gmo-miR-338-3p
  7. Homo sapiens (human) hsa-miR-338-3p
  8. Ictalurus punctatus ipu-miR-338
  9. Macaca mulatta mml-miR-338-3p
  10. Maylandia zebra mze-miR-338
  11. Mus musculus (house mouse) mmu-miR-338-3p
  12. Neolamprologus brichardi (lyretail cichlid) nbr-miR-338
  13. Oreochromis niloticus oni-miR-338
  14. Pan troglodytes (chimpanzee) ptr-miR-338
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-338-3p
  16. Pundamilia nyererei pny-miR-338
  17. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63002
  18. Salmo salar (Atlantic salmon) ssa-miR-338a-3p
  19. Sarcophilus harrisii sha-miR-338
  20. Sus scrofa ssc-miR-338
  21. Taeniopygia guttata tgu-miR-338-3p
  22. Takifugu rubripes fru-miR-338
  23. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-338
  24. Tor tambroides miR-338
  25. Xenopus laevis (African clawed frog) xla-miR-338
  26. Xenopus tropicalis (tropical clawed frog) xtr-miR-338