Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-652 URS0000013DD8_9593

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUGGCGCCACUAGGGUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (cattle) bta-miR-652
  2. Callithrix jacchus cja-miR-652a
  3. Canis lupus familiaris (dog) Cfa-Mir-652_3p (mature (guide))
  4. Cavia porcellus Cpo-Mir-652_3p (mature (guide))
  5. Cricetulus griseus cgr-miR-652-3p
  6. Dasypus novemcinctus dno-miR-652-3p
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-652_3p (mature (guide))
  8. Equus caballus (horse) eca-miR-652
  9. Gorilla gorilla gorilla ggo-miR-652 (MIR652)
  10. Homo sapiens hsa-miR-652-3p
  11. Macaca mulatta mml-miR-652
  12. Mus musculus mmu-miR-652-3p
  13. Oryctolagus cuniculus (rabbit) Ocu-Mir-652_3p (mature (guide))
  14. Pan troglodytes ptr-miR-652
  15. Pongo pygmaeus ppy-miR-652
  16. Rattus norvegicus rno-miR-652-3p
Publications