Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-652-3p URS0000013DD8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-652: Hsa-mir-652 is a microRNA that has been identified in various studies across different organisms, including humans and horses [PMC5424272]. It has been associated with different conditions and diseases, such as NOA (non-obstructive azoospermia) [PMC5226495], breast cancer [PMC5966243], metabolic syndrome [PMC3216936], schizophrenia [PMC3726785], pancreatic cancer [PMC7352720], PTCL/NOS (peripheral T-cell lymphoma, not otherwise specified) and ALCL/ALK- (anaplastic large cell lymphoma, anaplastic lymphoma kinase-negative) subtypes [PMC4335255]. Hsa-mir-652 has also been found to be dysregulated in alcoholics and is one of the highly expressed microRNAs in salivary microvesicles [PMC5858605] [PMC3422169]. It has been identified as a potential biomarker for early-stage breast cancer detection and for predicting the outcomes of patients with triple-negative breast cancer (TNBC) [PMC5966243] [PMC7499949]. Additionally, hsa-mir-652 has conserved mRNA targets such as ISL1, ACVR2B, and PSKH1 according to the Target Scan database [PMC3216936]. Furthermore, hsa-mir-652 is one of the miRNAs that can predict gene expression regulation in prostate cancer (PCa) when combined with other miRNAs such as hsa-mir-187 and hsa-mir-450b[ PMC8426106]. Overall, hsa-mir-652 plays a role in various biological processes and may have potential diagnostic or prognostic value in different diseases.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUGGCGCCACUAGGGUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (cattle) bta-miR-652
  2. Callithrix jacchus cja-miR-652a
  3. Canis lupus familiaris (dog) Cfa-Mir-652_3p (mature (guide))
  4. Cavia porcellus Cpo-Mir-652_3p (mature (guide))
  5. Cricetulus griseus cgr-miR-652-3p
  6. Dasypus novemcinctus dno-miR-652-3p
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-652_3p (mature (guide))
  8. Equus caballus (horse) eca-miR-652
  9. Gorilla gorilla gorilla ggo-miR-652 (MIR652)
  10. Gorilla gorilla (western gorilla) ggo-miR-652
  11. Macaca mulatta mml-miR-652
  12. Mus musculus mmu-miR-652-3p
  13. Oryctolagus cuniculus (rabbit) Ocu-Mir-652_3p (mature (guide))
  14. Pan troglodytes ptr-miR-652
  15. Pongo pygmaeus ppy-miR-652
  16. Rattus norvegicus rno-miR-652-3p
Publications