Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-let-7e URS000000B1C9_9823

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Sus scrofa. Annotated by 3 databases (miRBase, ENA, RefSeq). Sus scrofa (pig) ssc-let-7e sequence is a product of ssc-let-7e, let-7e, let-7, MIRLET7E genes. Found in the pig reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGUAGGAGGUUGUAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Bos taurus (cattle) Bta-Let-7-P1b_5p (mature (guide))
    2. Callithrix jacchus cja-let-7e
    3. Canis lupus familiaris cfa-let-7e
    4. Capra hircus chi-let-7e-5p
    5. Cavia porcellus cpo-let-7e-5p
    6. Cervus elaphus (red deer) cel-let-7e
    7. Echinops telfairi Ete-Let-7-P1b_5p (mature (guide))
    8. Equus caballus (horse) eca-let-7e
    9. Homo sapiens hsa-let-7e-5p
    10. Macaca mulatta (Rhesus monkey) mml-let-7e-5p
    11. Mus musculus (house mouse) mmu-let-7e-5p
    12. Nomascus leucogenys nle-let-7e
    13. Oryctolagus cuniculus Ocu-Let-7-P1b_5p (mature (guide))
    14. Otolemur garnettii (small-eared galago) oga-let-7e
    15. Pan paniscus ppa-let-7e
    16. Pan troglodytes ptr-let-7e
    17. Papio hamadryas (hamadryas baboon) pha-let-7e
    18. Pongo pygmaeus (Bornean orangutan) ppy-let-7e
    19. Pteropus alecto (black flying fox) pal-let-7e-5p
    20. Rattus norvegicus rno-let-7e-5p
    21. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-let-7e
    22. Tupaia chinensis (Chinese tree shrew) tch-let-7e-5p
    Publications New