Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-let-7e URS000000B1C9_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-let-7e: Ssc-let-7e is a microRNA (miRNA) that can be generated from miRNA-offset RNAs (moRNAs) [PMC4001129]. It has been found to be downregulated in chronic T. gondii infection, potentially targeting the TMEM173 gene and playing a role in the regulation of type I IFN-dependent innate immunity and inflammatory responses [PMC8851844]. Ssc-let-7e, along with other miRNAs such as ssc-miR-328, ssc-miR-128, ssc-miR-129a-3p, ssc-miR-28-3p, and ssc-miR-30c-3p, may also be involved in regulating the chemotaxis of immune cells [PMC8851844]. In Bama minipigs, the let-7 family of miRNAs including ssc-miR98 and ssc-let7e were found to be upregulated or downregulated in different contexts [PMC4489742]. In APC1311 pigs with early-stage colorectal neoplasia, several miRNAs including ssclet7e were associated with the disease [PMC5707088]. In more advanced HG-IEN samples compared to LG-IEN samples, levels of ssclet7e were significantly elevated [PMC5707088]. Ssclet7e was also one of ten differentially expressed miRNAs validated by qRTPCR in this study [PMC5707088]. Sscl et 7e is one of several small RNAs that can be generated from loops or regions between loops and stems [PMC4008308]. The let 7 family including sscl et 7a sscl et 7c sscl et 7d sscl et 7f sscl et 7g sscl et 7i and sscmir98 was found to be significantly differentially expressed in PRRSV-infected PAMs [PMC9550049]. Among conserved miRNAs, ssclet7a, ssclet7f, ssclet7c, ssclet7e, sscmiR103, sscmiR1403p, sscmiR199a3p and sscmiR199b3p had high read counts [PMC5815207].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGGAGGUUGUAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus Bta-Let-7-P1b_5p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7e
  3. Canis lupus familiaris (dog) cfa-let-7e
  4. Capra hircus chi-let-7e-5p
  5. Cavia porcellus cpo-let-7e-5p
  6. Cervus elaphus cel-let-7e
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P1b_5p (mature (guide))
  8. Equus caballus (horse) eca-let-7e
  9. Homo sapiens hsa-let-7e-5p
  10. Macaca mulatta mml-let-7e-5p
  11. Mus musculus (house mouse) mmu-let-7e-5p
  12. Nomascus leucogenys nle-let-7e
  13. Oryctolagus cuniculus Ocu-Let-7-P1b_5p (mature (guide))
  14. Otolemur garnettii oga-let-7e
  15. Pan paniscus ppa-let-7e
  16. Pan troglodytes ptr-let-7e
  17. Papio hamadryas (hamadryas baboon) pha-let-7e
  18. Pongo pygmaeus ppy-let-7e
  19. Pteropus alecto pal-let-7e-5p
  20. Rattus norvegicus (Norway rat) rno-let-7e-5p
  21. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-let-7e
  22. Tupaia chinensis (Chinese tree shrew) tch-let-7e-5p
Publications