v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-let-7e-5p URS000000B1C9_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-let-7e: Mmu-let-7e is a specific type of miRNA that is targeted by miRNA inhibitors [PMC9455749]. The miRNA inhibitors were designed using the target mature miRNA and sequence [PMC9455749]. The specific sequence for the mmu-let-7e inhibitor is 5′-ACUCCAUCCUCCAACAUACCAA-3′ [PMC9455749]. Oligonucleotide pairs containing Pmel and Xba1 restriction sites were generated for the mouse mmu-let-7e UTR region [PMC3443208]. These oligonucleotide pairs were generated by IDT DNA [PMC3443208]. The mmu-let-7e sense target sequence is 5′-AAACTAGCGGCCGCTAGTAACTATACAACCTCCTACCTCAT -3′ and the antisense target sequence is 5′ - CTAGATGAGGTAGGAGGTTGTATAGTTACTAGCGGCCGCTA GTTT -3′ [PMC3443208]. Additionally, a scramble sense target sequence and a scramble antisense target sequence were also generated for mmu-let-e7 [PMC3443208].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUAGGAGGUUGUAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus Bta-Let-7-P1b_5p (mature (guide))
  2. Callithrix jacchus cja-let-7e
  3. Canis lupus familiaris (dog) cfa-let-7e
  4. Capra hircus (goat) chi-let-7e-5p
  5. Cavia porcellus cpo-let-7e-5p
  6. Cervus elaphus cel-let-7e
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P1b_5p (mature (guide))
  8. Equus caballus eca-let-7e
  9. Homo sapiens hsa-let-7e-5p
  10. Macaca mulatta mml-let-7e-5p
  11. Nomascus leucogenys nle-let-7e
  12. Oryctolagus cuniculus (rabbit) Ocu-Let-7-P1b_5p (mature (guide))
  13. Otolemur garnettii (small-eared galago) oga-let-7e
  14. Pan paniscus ppa-let-7e
  15. Pan troglodytes ptr-let-7e
  16. Papio hamadryas (hamadryas baboon) pha-let-7e
  17. Pongo pygmaeus (Bornean orangutan) ppy-let-7e
  18. Pteropus alecto pal-let-7e-5p
  19. Rattus norvegicus rno-let-7e-5p
  20. Saimiri boliviensis boliviensis sbo-let-7e
  21. Sus scrofa (pig) ssc-let-7e
  22. Tupaia chinensis tch-let-7e-5p
 Publications