Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (northern white-cheeked gibbon) nle-let-7e URS000000B1C9_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGGAGGUUGUAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus Bta-Let-7-P1b_5p (mature (guide))
  2. Callithrix jacchus cja-let-7e
  3. Canis lupus familiaris (dog) cfa-let-7e
  4. Capra hircus (goat) chi-let-7e-5p
  5. Cavia porcellus cpo-let-7e-5p
  6. Cervus elaphus cel-let-7e
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P1b_5p (mature (guide))
  8. Equus caballus eca-let-7e
  9. Homo sapiens hsa-let-7e-5p
  10. Macaca mulatta mml-let-7e-5p
  11. Mus musculus (house mouse) mmu-let-7e-5p
  12. Oryctolagus cuniculus (rabbit) Ocu-Let-7-P1b_5p (mature (guide))
  13. Otolemur garnettii (small-eared galago) oga-let-7e
  14. Pan paniscus ppa-let-7e
  15. Pan troglodytes ptr-let-7e
  16. Papio hamadryas (hamadryas baboon) pha-let-7e
  17. Pongo pygmaeus (Bornean orangutan) ppy-let-7e
  18. Pteropus alecto pal-let-7e-5p
  19. Rattus norvegicus rno-let-7e-5p
  20. Saimiri boliviensis boliviensis sbo-let-7e
  21. Sus scrofa (pig) ssc-let-7e
  22. Tupaia chinensis tch-let-7e-5p