Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7e-5p URS000000B1C9_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (IntAct, TarBase, MirGeneDB, RefSeq, PSICQUIC, ENA, miRBase, GeneCards, LncBase, MalaCards). Described in 55 papers. Homo sapiens (human) hsa-let-7e-5p sequence is a product of let-7e-5p, hsa-let-7e-5p, let-7, MIRLET7E, let-7e, hsa-let-7e genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 12CC4, 14-3-3, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 182-FIP, 2'-PDE, 20D7-FC4, 2610509L04Rik.

Interactions 11

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-let-7e-5p interacts with:

Interaction id Participant Synonyms
EBI-25653510 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
URS000000B1C9_9606-5 P05231 P05231
URS000000B1C9_9606-0 P05231 P05231
URS000000B1C9_9606-1 P08887 P08887
URS000000B1C9_9606-6 P08887 P08887
URS000000B1C9_9606-7 P40763 P40763
URS000000B1C9_9606-4 P40763 P40763
URS000000B1C9_9606-2 Q14683 Q14683
URS000000B1C9_9606-8 Q14683 Q14683
URS000000B1C9_9606-9 Q9UL18 Q9UL18
URS000000B1C9_9606-3 Q9UL18 Q9UL18

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGGUAGGAGGUUGUAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 34 other species

    1. Bos taurus (cattle) Bta-Let-7-P1b_5p (mature (guide))
    2. Callithrix jacchus cja-let-7e
    3. Canis lupus familiaris cfa-let-7e
    4. Capra hircus chi-let-7e-5p
    5. Cavia porcellus (domestic guinea pig) cpo-let-7e-5p
    6. Cervus elaphus (red deer) cel-let-7e
    7. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P1b_5p (mature (guide))
    8. Equus caballus (horse) eca-let-7e
    9. Macaca mulatta mml-let-7e-5p
    10. Mus musculus (house mouse) mmu-let-7e-5p
    11. Nomascus leucogenys nle-let-7e
    12. Otolemur garnettii oga-let-7e
    13. Pan paniscus ppa-let-7e
    14. Pan troglodytes (chimpanzee) ptr-let-7e
    15. Papio hamadryas (hamadryas baboon) pha-let-7e
    16. Pongo pygmaeus ppy-let-7e
    17. Pteropus alecto pal-let-7e-5p
    18. Rattus norvegicus rno-let-7e-5p
    19. Saimiri boliviensis boliviensis sbo-let-7e
    20. Sus scrofa ssc-let-7e
    21. Tupaia chinensis tch-let-7e-5p