Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7e-5p URS000000B1C9_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (MalaCards, MirGeneDB, PSICQUIC, IntAct, miRBase, RefSeq, GeneCards, TarBase, ENA, LncBase). Homo sapiens (human) hsa-let-7e-5p sequence is a product of hsa-let-7e, let-7e-5p, hsa-let-7e-5p, MIRLET7E, let-7e, let-7 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 12CC4, 14-3-3, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 182-FIP, 2'-PDE, 20D7-FC4, 2610509L04Rik.

Interactions 11

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-let-7e-5p interacts with:

Interaction id Participant Synonyms
EBI-25653510 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
URS000000B1C9_9606-5 P05231 P05231
URS000000B1C9_9606-0 P05231 P05231
URS000000B1C9_9606-1 P08887 P08887
URS000000B1C9_9606-6 P08887 P08887
URS000000B1C9_9606-7 P40763 P40763
URS000000B1C9_9606-4 P40763 P40763
URS000000B1C9_9606-2 Q14683 Q14683
URS000000B1C9_9606-8 Q14683 Q14683
URS000000B1C9_9606-9 Q9UL18 Q9UL18
URS000000B1C9_9606-3 Q9UL18 Q9UL18

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGUAGGAGGUUGUAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 145 other species

    1. Bos taurus (cattle) Bta-Let-7-P1b_5p (mature (guide))
    2. Callithrix jacchus cja-let-7e
    3. Canis lupus familiaris (dog) cfa-let-7e
    4. Capra hircus chi-let-7e-5p
    5. Cavia porcellus cpo-let-7e-5p
    6. Cervus elaphus (red deer) cel-let-7e
    7. Echinops telfairi Ete-Let-7-P1b_5p (mature (guide))
    8. Equus caballus eca-let-7e
    9. Macaca mulatta mml-let-7e-5p
    10. Mus musculus mmu-let-7e-5p
    11. Nomascus leucogenys (northern white-cheeked gibbon) nle-let-7e
    12. Oryctolagus cuniculus (rabbit) Ocu-Let-7-P1b_5p (mature (guide))
    13. Otolemur garnettii oga-let-7e
    14. Pan paniscus (pygmy chimpanzee) ppa-let-7e
    15. Pan troglodytes ptr-let-7e
    16. Papio hamadryas pha-let-7e
    17. Pongo pygmaeus (Bornean orangutan) ppy-let-7e
    18. Pteropus alecto (black flying fox) pal-let-7e-5p
    19. Rattus norvegicus rno-let-7e-5p
    20. Saimiri boliviensis boliviensis sbo-let-7e
    21. Sus scrofa ssc-let-7e
    22. Tupaia chinensis (Chinese tree shrew) tch-let-7e-5p
    Publications New