Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tch-let-7e-5p URS000000B1C9_246437

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGGAGGUUGUAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus Bta-Let-7-P1b_5p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7e
  3. Canis lupus familiaris (dog) cfa-let-7e
  4. Capra hircus chi-let-7e-5p
  5. Cavia porcellus cpo-let-7e-5p
  6. Cervus elaphus cel-let-7e
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P1b_5p (mature (guide))
  8. Equus caballus (horse) eca-let-7e
  9. Homo sapiens hsa-let-7e-5p
  10. Macaca mulatta mml-let-7e-5p
  11. Mus musculus (house mouse) mmu-let-7e-5p
  12. Nomascus leucogenys nle-let-7e
  13. Oryctolagus cuniculus Ocu-Let-7-P1b_5p (mature (guide))
  14. Otolemur garnettii oga-let-7e
  15. Pan paniscus ppa-let-7e
  16. Pan troglodytes ptr-let-7e
  17. Papio hamadryas (hamadryas baboon) pha-let-7e
  18. Pongo pygmaeus ppy-let-7e
  19. Pteropus alecto pal-let-7e-5p
  20. Rattus norvegicus (Norway rat) rno-let-7e-5p
  21. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-let-7e
  22. Sus scrofa ssc-let-7e
Publications