Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-143 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-143 precursor URS0000008A99_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir143: MIR143 is a microRNA that plays a significant role in the regulation of various cellular processes, such as inflammation and apoptosis, particularly in the context of obesity [PMC9687157]. Studies have identified a negative correlation between the levels of MIR143 and the mRNA of pro-inflammatory cytokines like IL1β, IL6, and TNFα in the ovaries of obese individuals [PMC9687157]. This correlation suggests that MIR143 could be involved in the modulation of inflammatory responses that are associated with obesity [PMC9687157]. Moreover, the over-expression of MIR143 has been associated with a decrease in the expression of its predicted target proteins, which include hexokinase 2 (HK2) and the beta-1 adrenergic receptor (ADRB1) [PMC5735881]. These target proteins are known to be involved in metabolic pathways and the cellular response to stress [PMC5735881]. Additionally, an increase in MIR143 levels leads to a lower Bcl-2/Bax ratio, which is indicative of its potential impact on the mechanisms of apoptosis [PMC5735881]. Taken together, these findings suggest that MIR143 could have therapeutic relevance for the treatment of obesity-related inflammation and the metabolic disturbances that accompany it [PMC5735881; PMC9687157].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

GoFlow Results Publications