Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 143 (ENSPTEG00000020691.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 143 (ENSPTEG00000020691.1) URS0000008A99_591936

106 nucleotides
1 database (Ensembl)
Found in 12 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-143 (ENSGGOG00000034713.2)
Gorilla gorilla (western gorilla) microRNA ggo-mir-143 precursor
Homo sapiens microRNA hsa-mir-143 precursor
Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-143 precursor
Pongo abelii (Sumatran orangutan) microRNA 143 (ENSPPYG00000022126.2)
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-143 precursor
Rhinopithecus bieti (Black snub-nosed monkey) microRNA 143 (ENSRBIG00000007149.1)
Rhinopithecus roxellana microRNA 143 (ENSRROG00000002138.1)