Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-99a-3p URS0000006A47_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-99a: Gga-mir-99a is a microRNA that has been studied in various contexts, including its effects in MG-mediated inflammation in chickens [PMC5979595]. It has been found that several other microRNAs, such as gga-miR-18, gga-miR-193a, gga-miR-193b, and gga-miR-30b, are differentially expressed in chicken lungs infected with avian influenza virus [PMC5389138]. In other studies, miRNAs such as miR-574-3p and miR-30a were found to be differentially expressed in cells infected with influenza A virus [PMC5389138]. Gga-mir-99a has been shown to target the SMARCA5 gene and regulate Mycoplasma gallisepticum infection by suppressing cell proliferation in chickens [PMC6663980]. It has also been observed that gga-mir-99a is down-regulated in MG-infected lungs of specific pathogen-free chicken embryos [PMC6663980]. Additionally, gga-mir-99a is one of the miRNAs predicted to target SREBP-1c and is up-regulated in the liver of leptin-treated chickens [PMC3436634]. Gga-mir-99a has also been detected as enhanced in response to M. gallisepticum infection and its over-expression leads to a decrease in cell proliferation [PMC7238135]. Overall, studies have shown that gga-mir-99a plays important roles in various infections and may have potential therapeutic implications for diseases such as chronic respiratory disease (CRD) caused by Mycoplasma gallisepticum infection [PMC6121889][PMC6562429][PMC7734234].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAGCUCGCUUCUAUGGGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Homo sapiens microRNA hsa-mir-RG-125
  2. Sus scrofa (pig) ssc-miR-99a-3p
  3. Taeniopygia guttata tgu-miR-99-3p
Publications