Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-99a-3p URS0000006A47_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-99a: Ssc-mir-99a is a miRNA that is upregulated in European and Asian breeds, and its expression varies depending on the breed [PMC3555835]. It is one of the miRNAs that showed significant differential expression in breed groups [PMC3555835]. Ssc-mir-99a, along with other miRNAs, has been found to be involved in cancer pathways and pathways related to cell cycle, growth, and death [PMC3555835]. In terms of expression patterns, some miRNAs have a strong predominant isomiR, while others do not [PMC3555835]. Ssc-mir-99a was found to be downregulated in Asian breeds [PMC3555835]. It was also one of the most expressed miRNAs in Iberian breed [PMC3555835]. Ssc-mir-99a has been identified as a potential target for differentially expressed miRNAs in various comparisons [PMC3555835]. In addition to its role in breed-specific expression patterns, ssc-mir-99a has also been implicated in reproduction pathways [PMC3555835]. The most abundant known miRNAs include ssc-miR-148a-3p, ssc-let-7g, ssc-let-7f, 3_8760, ssc-miR-26a, ssc-miR-451, ssc-miR21,s scmiR30d,s scmir99a and s scmiR103[ PMC7903524].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAGCUCGCUUCUAUGGGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gallus gallus (chicken) gga-miR-99a-3p
  2. Homo sapiens microRNA hsa-mir-RG-125
  3. Taeniopygia guttata tgu-miR-99-3p
Publications