Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) Cfa-Mir-210_3p (mature (guide)) URS000055128B_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUGCGUGUGACAGCGGCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Bos taurus (cattle) Bta-Mir-210_3p (mature (guide))
  2. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-210-5p
  3. Branchiostoma floridae bfl-miR-210-3p
  4. Branchiostoma lanceolatum Bla-Mir-210_3p (mature (guide))
  5. Capra hircus (goat) miR-210
  6. Cavia porcellus cpo-miR-210-3p
  7. Cricetulus griseus cgr-miR-210-3p
  8. Dasypus novemcinctus dno-miR-210-3p
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-210_3p (mature (guide))
  10. Gorilla gorilla gorilla ggo-miR-210 (MIR210)
  11. Gorilla gorilla (western gorilla) ggo-miR-210
  12. Homo sapiens hsa-miR-210-3p
  13. Macaca mulatta (Rhesus monkey) mml-miR-210-3p
  14. Mus musculus (house mouse) mmu-miR-210-3p
  15. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-210
  16. Oryctolagus cuniculus (rabbit) Ocu-Mir-210_3p (mature (guide))
  17. Otolemur garnettii (small-eared galago) oga-miR-210
  18. Ovis aries (sheep) miscellaneous RNA
  19. Pan paniscus ppa-miR-210
  20. Pan troglodytes ptr-miR-210
  21. Papio hamadryas pha-miR-210
  22. Rattus norvegicus rno-miR-210-3p
  23. Sus scrofa ssc-miR-210
  24. Tupaia chinensis (Chinese tree shrew) tch-miR-210