Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-210-3p URS000055128B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-210: Hsa-mir-210 is a microRNA that has been extensively studied in various contexts [PMC5400787]. It has been associated significantly with mRNA in NCRM, and pathway analysis using QIAGEN Ingenuity Pathway Analysis was performed to understand its role [PMC5400787]. In a study involving HepG2 and HuH-7 cells, hsa-mir-210 was reverse transcribed from total RNA using the TaqMan® MicroRNA Reverse Transcription Kit [PMC6775050]. Hsa-mir-210 is one of the miRNAs found in a set of 24 models, along with other miRNAs such as hsa-miR-9 and hsa-miR-375 [PMC8870702]. In triple-negative breast cancer (TNBC) tissues and plasma, hsa-mir-210 is among the overexpressed miRNAs along with hsa-miR-19a and hsa-miR-19b [PMC5706292]. Hsa-mir-210 is known to be regulated by hypoxia and acts as a tumor suppressor by regulating tumor cell growth, angiogenesis, and apoptosis [PMC5221119]. In the context of hepatitis C virus (HCV), alterations in various miRNAs including hsa-mir-210 have been associated with HCV severity and liver function deterioration [PMC10138470].

mRNA interactions 15 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUGCGUGUGACAGCGGCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Bos taurus (cattle) Bta-Mir-210_3p (mature (guide))
  2. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-210-5p
  3. Branchiostoma floridae bfl-miR-210-3p
  4. Branchiostoma lanceolatum Bla-Mir-210_3p (mature (guide))
  5. Canis lupus familiaris (dog) Cfa-Mir-210_3p (mature (guide))
  6. Capra hircus (goat) miR-210
  7. Cavia porcellus cpo-miR-210-3p
  8. Cricetulus griseus cgr-miR-210-3p
  9. Dasypus novemcinctus dno-miR-210-3p
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-210_3p (mature (guide))
  11. Gorilla gorilla gorilla ggo-miR-210 (MIR210)
  12. Gorilla gorilla (western gorilla) ggo-miR-210
  13. Macaca mulatta (Rhesus monkey) mml-miR-210-3p
  14. Mus musculus (house mouse) mmu-miR-210-3p
  15. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-210
  16. Oryctolagus cuniculus (rabbit) Ocu-Mir-210_3p (mature (guide))
  17. Otolemur garnettii (small-eared galago) oga-miR-210
  18. Ovis aries (sheep) miscellaneous RNA
  19. Pan paniscus ppa-miR-210
  20. Pan troglodytes ptr-miR-210
  21. Papio hamadryas pha-miR-210
  22. Rattus norvegicus rno-miR-210-3p
  23. Sus scrofa ssc-miR-210
  24. Tupaia chinensis (Chinese tree shrew) tch-miR-210
Publications