Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-193a-5p URS0000367985_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-193a: Gga-mir-193a is a microRNA that has been found to be abnormally expressed in ALV-J-infected chickens and is potentially associated with ALV-J-induced tumorigenesis (Wang et al., 2013a) [PMC5276853]. Several other miRNAs, including gga-mir-193a, have also been reported to be associated with tumorigenesis and the aberrant expression of ALV-J (Li et al., 2012; Wang et al., 2013a,b; Li H. et al., 2014; Dai et al., 2015; Li et al., 2015) [PMC5276853]. In addition, gga-mir-193a has been found to be upregulated in primary hepatocytes of female chickens treated with GH, suggesting its potential role in lipid metabolism (PMC8002044). Microarray analysis of liver tumors from ALV-J-infected chickens has shown differential expression of gga-mir-193a, along with other miRNAs (PMC5065965). Furthermore, gga-mir-193a has been found to be upregulated in chicken hepatocytes treated with GH (PMC7936154). It is also involved in regulating metabolic processes in chickens along with its related miRNA gga-miR-193b (PMC7936154). Lastly, the differential expression of gga-miR-221, gga-mir-193a, gga-miR-193b and gga-miR-125b has been detected in hepatic tumor tissues of chickens after ALV-J infection and these miRNAs are involved in tumorigenesis-related signaling pathways (PMC6862082).

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGUCUUUGCGGGCGAGAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Anolis carolinensis Aca-Mir-193-P1b_5p (mature (guide))
  2. Bos taurus bta-miR-193a-5p
  3. Canis lupus familiaris cfa-miR-193a
  4. Cavia porcellus (domestic guinea pig) cpo-miR-193a-5p
  5. Cervus elaphus (red deer) cel-miR-193a-5p
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-193-P1b_5p (mature (guide))
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-193a-5p
  8. Equus caballus eca-miR-193a-5p
  9. Homo sapiens hsa-miR-193a-5p
  10. Macaca mulatta (Rhesus monkey) mml-miR-193a-5p
  11. Ophiophagus hannah (king cobra) oha-miR-193-5p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-193a-5p
  13. Pongo pygmaeus ppy-miR-193a-5p
  14. Pteropus alecto (black flying fox) pal-miR-193a-5p
  15. Python bivittatus (Burmese python) pbv-miR-193a-5p
  16. Sarcophilus harrisii Sha-Mir-193-P1b_5p (mature (guide))
  17. Sphenodon punctatus Spt-Mir-193-P1b_5p (mature (guide))
  18. Sus scrofa (pig) ssc-miR-193a-5p
  19. Taeniopygia guttata tgu-miR-193b-5p
Publications