Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-193a-5p URS0000367985_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-193a: Hsa-mir-193a is a microRNA that has been found to be significantly upregulated in gestational diabetes mellitus (GDM) patients during the first trimester [PMC9700700]. In studies using INS-1E or primary β-cells, the endogenous activity of miR-193a was inhibited using miRCURY LNA Inhibitor hsa-mir-193a [PMC6009611]. Hsa-mir-193a has also been found to modulate apoptotic processes by promoting CASP3 activation induced by TNFSF10 signaling [PMC3759901]. Additionally, hsa-mir-193a is one of the miRNAs used in calculating risk scores for certain conditions, with its expression level contributing positively to the score [PMC3069027]. Hsa-mir-193a has also been implicated in drug resistance, specifically in cytotoxic resistance genes and endocrine therapy resistance genes [PMC8266326]. In a comparison between patients in remission and control samples, hsa-mir-193a was identified as one of the miRNAs likely to be implicated in relapses [PMC2708922]. Furthermore, hsa-mir-193a expression levels have been observed to steadily increase over a 72-hour period post-infection [PMC3258008]. References: [PMC9700700] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9700700/ [PMC6009611] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6009611/ [PMC3759901] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3759901/ [PMC3069027] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3069027/ [PM8266326] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM8266326/ [PMC2708922] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2708922/ [PMC3258008] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3258008/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGUCUUUGCGGGCGAGAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

Publications