Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anolis carolinensis (green anole) Aca-Mir-193-P1b_5p (mature (guide)) URS0000367985_28377

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGUCUUUGCGGGCGAGAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Bos taurus bta-miR-193a-5p
  2. Canis lupus familiaris cfa-miR-193a
  3. Cavia porcellus (domestic guinea pig) cpo-miR-193a-5p
  4. Cervus elaphus (red deer) cel-miR-193a-5p
  5. Chrysemys picta bellii (western painted turtle) Cpi-Mir-193-P1b_5p (mature (guide))
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-193a-5p
  7. Equus caballus eca-miR-193a-5p
  8. Gallus gallus (chicken) gga-miR-193a-5p
  9. Homo sapiens hsa-miR-193a-5p
  10. Macaca mulatta (Rhesus monkey) mml-miR-193a-5p
  11. Ophiophagus hannah (king cobra) oha-miR-193-5p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-193a-5p
  13. Pongo pygmaeus ppy-miR-193a-5p
  14. Pteropus alecto (black flying fox) pal-miR-193a-5p
  15. Python bivittatus (Burmese python) pbv-miR-193a-5p
  16. Sarcophilus harrisii Sha-Mir-193-P1b_5p (mature (guide))
  17. Sphenodon punctatus Spt-Mir-193-P1b_5p (mature (guide))
  18. Sus scrofa (pig) ssc-miR-193a-5p
  19. Taeniopygia guttata tgu-miR-193b-5p