Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-191 URS000035F92F_9940

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAACGGAAUCCCAAAAGCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Alligator mississippiensis (American alligator) ami-miR-191-5p
  2. Canis lupus familiaris cfa-miR-191
  3. Capra hircus chi-miR-191-5p
  4. Cervus elaphus (red deer) cel-miR-191
  5. Chrysemys picta (Painted turtle) cpi-miR-191-5p
  6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-191-5p
  7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72495
  8. Ornithorhynchus anatinus oan-miR-191-5p
  9. Pteropus alecto (black flying fox) pal-miR-191-5p
  10. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62976
  11. Taeniopygia guttata Tgu-Mir-191_5p (mature (guide))
  12. Tupaia chinensis tch-miR-191-5p
  13. Tursiops truncatus (common bottlenose dolphin) miR-191
  14. Xenopus laevis xla-miR-191-5p
  15. Xenopus tropicalis xtr-miR-191
Publications