v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-191-5p URS000035F92F_13616

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAACGGAAUCCCAAAAGCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Alligator mississippiensis (American alligator) ami-miR-191-5p
  2. Canis lupus familiaris cfa-miR-191
  3. Capra hircus chi-miR-191-5p
  4. Cervus elaphus (red deer) cel-miR-191
  5. Chrysemys picta (Painted turtle) cpi-miR-191-5p
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72495
  7. Ornithorhynchus anatinus oan-miR-191-5p
  8. Ovis aries oar-miR-191
  9. Pteropus alecto (black flying fox) pal-miR-191-5p
  10. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62976
  11. Taeniopygia guttata Tgu-Mir-191_5p (mature (guide))
  12. Tupaia chinensis tch-miR-191-5p
  13. Tursiops truncatus (common bottlenose dolphin) miR-191
  14. Xenopus laevis xla-miR-191-5p
  15. Xenopus tropicalis xtr-miR-191
 Publications