Cervus elaphus (red deer) cel-miR-191

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-191 URS000035F92F_9860

22 nucleotides
1 database (ENA)
Found in 15 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CAACGGAAUCCCAAAAGCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

Alligator mississippiensis (American alligator) ami-miR-191-5p
Canis lupus familiaris cfa-miR-191
Capra hircus chi-miR-191-5p
Chrysemys picta (Painted turtle) cpi-miR-191-5p
Monodelphis domestica (gray short-tailed opossum) mdo-miR-191-5p
Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72495
Ornithorhynchus anatinus oan-miR-191-5p
Ovis aries oar-miR-191
Pteropus alecto (black flying fox) pal-miR-191-5p
Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62976
Taeniopygia guttata Tgu-Mir-191_5p (mature (guide))
Tupaia chinensis tch-miR-191-5p
Tursiops truncatus (common bottlenose dolphin) miR-191
Xenopus laevis xla-miR-191-5p
Xenopus tropicalis xtr-miR-191