Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-155 URS0000338542_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-155: Bta-mir-155 is a conserved miRNA that has been studied in various contexts. In a study comparing time points in humans, hsa-miR-155-5p, which is homologous to bta-mir-155, showed significant contrasts [PMC9825267]. Another study comparing grazing and corn silage groups found that bta-mir-155 was more abundant in the grazing farms [PMC9569736]. Bta-mir-155 has also been investigated in relation to bovine mastitis. It was found to be one of the miRNAs integrated with differentially expressed genes (DEGs) and other mastitis-related miRNAs [PMC8511192]. Specifically, bta-mir-155 was identified along with bta-miR-146a, bta-miR-21-5p, bta-miR-31, and bta-miR16a [PMC8511192]. In granulosa cells of SF (superovulated follicles), the expression level of bta-mir-155 was significantly upregulated at day 7 compared to day 3 [PMC4156418]. Bta-mir-155 has also been implicated in the regulation of IL18 along with other factors such as bta-miR16a and HNF3 transcription factor [PMC8511192]. These studies highlight the involvement of bta-mir-155 in various biological processes and its potential as a biomarker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAUGCUAAUCGUGAUAGGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Canis lupus familiaris (dog) cfa-miR-155
  2. Capra hircus chi-miR-155-5p
  3. Cervus elaphus (red deer) cel-miR-155
  4. Columba livia (rock pigeon) cli-miR-155-5p
  5. Equus caballus (horse) eca-miR-155
  6. Gadus morhua gmo-miR-155-5p
  7. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-155
  8. Homo sapiens hsa-miR-155-5p
  9. Macaca mulatta mml-miR-155
  10. Maylandia zebra mze-miR-155
  11. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-155_5p (mature (guide))
  12. Neolamprologus brichardi (lyretail cichlid) nbr-miR-155
  13. Oreochromis niloticus (Nile tilapia) oni-miR-155
  14. Ornithorhynchus anatinus (platypus) oan-miR-155-5p
  15. Pan troglodytes (chimpanzee) ptr-miR-155
  16. Papio hamadryas pha-miR-155
  17. Pongo pygmaeus ppy-miR-155
  18. Pteropus alecto pal-miR-155-5p
  19. Pundamilia nyererei pny-miR-155
  20. Salmo salar ssa-miR-155-5p
  21. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-155_5p (mature (guide))
  22. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-155_5p (mature (guide))
  23. Tupaia chinensis tch-miR-155-5p
Publications