Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-155 URS0000338542_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-155: Eca-mir-155 is a type of microRNA that has been shown to target inflammatory immune response genes such as TNF receptor associated factor 6 (TRAF6), tumor necrosis factor alpha (TNFα), interleukin 6 (IL6), interleukin 8 (IL8), and interleukin 10 (IL10) [PMC8227551]. In a study investigating the expression profile of eca-mir-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 in mares with endometritis, it was found that the relative abundance of these microRNAs was higher in both young and old diseased mares compared to control healthy mares [PMC8227551]. These microRNAs were identified as potential targets [PMC8227551]. This study is the first to investigate the expression profile of these microRNAs in mares with endometritis [PMC8227551]. The study aimed to investigate the expression profile of these microRNAs and measure the concentrations of IL-6, PGF2α, and PGE2 in serum samples from young and old mares with healthy and abnormal uterine status [PMC8227551]. In old mares, higher expression levels of eca-mir-155, eca-miR-223, eca-miR-200a, and eca-miR-205 were observed compared to young diseased mares as well as control mares [PMC8227551].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAUGCUAAUCGUGAUAGGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Bos taurus (cattle) bta-miR-155
  2. Canis lupus familiaris (dog) cfa-miR-155
  3. Capra hircus chi-miR-155-5p
  4. Cervus elaphus (red deer) cel-miR-155
  5. Columba livia (rock pigeon) cli-miR-155-5p
  6. Gadus morhua gmo-miR-155-5p
  7. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-155
  8. Homo sapiens hsa-miR-155-5p
  9. Macaca mulatta mml-miR-155
  10. Maylandia zebra mze-miR-155
  11. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-155_5p (mature (guide))
  12. Neolamprologus brichardi (lyretail cichlid) nbr-miR-155
  13. Oreochromis niloticus (Nile tilapia) oni-miR-155
  14. Ornithorhynchus anatinus (platypus) oan-miR-155-5p
  15. Pan troglodytes (chimpanzee) ptr-miR-155
  16. Papio hamadryas pha-miR-155
  17. Pongo pygmaeus ppy-miR-155
  18. Pteropus alecto pal-miR-155-5p
  19. Pundamilia nyererei pny-miR-155
  20. Salmo salar ssa-miR-155-5p
  21. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-155_5p (mature (guide))
  22. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-155_5p (mature (guide))
  23. Tupaia chinensis tch-miR-155-5p
Publications