Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Papio hamadryas (hamadryas baboon) pha-miR-155 URS0000338542_9557

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAUGCUAAUCGUGAUAGGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Bos taurus (cattle) bta-miR-155
  2. Canis lupus familiaris (dog) cfa-miR-155
  3. Capra hircus chi-miR-155-5p
  4. Cervus elaphus (red deer) cel-miR-155
  5. Columba livia (rock pigeon) cli-miR-155-5p
  6. Equus caballus (horse) eca-miR-155
  7. Gadus morhua gmo-miR-155-5p
  8. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-155
  9. Homo sapiens hsa-miR-155-5p
  10. Macaca mulatta mml-miR-155
  11. Maylandia zebra mze-miR-155
  12. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-155_5p (mature (guide))
  13. Neolamprologus brichardi (lyretail cichlid) nbr-miR-155
  14. Oreochromis niloticus (Nile tilapia) oni-miR-155
  15. Ornithorhynchus anatinus (platypus) oan-miR-155-5p
  16. Pan troglodytes (chimpanzee) ptr-miR-155
  17. Pongo pygmaeus ppy-miR-155
  18. Pteropus alecto pal-miR-155-5p
  19. Pundamilia nyererei pny-miR-155
  20. Salmo salar ssa-miR-155-5p
  21. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-155_5p (mature (guide))
  22. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-155_5p (mature (guide))
  23. Tupaia chinensis tch-miR-155-5p