v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Gln (anticodon TTG) 3-1 (TRQ-TTG3 1 to 3) secondary structure diagram

Homo sapiens (human) tRNA-Gln (anticodon TTG) 3-1 (TRQ-TTG3 1 to 3) URS00002901EC_9606

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCCCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 152 other species

  1. Acinonyx jubatus (cheetah) tRNA
  2. Actinia equina (Beadlet anemone) tRNA tRNAscan-SE.tRNA.utg26037.Gln(TTG).1
  3. Ailuropoda melanoleuca tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  4. Anabarilius grahami tRNA
  5. Aotus nancymaae (Ma's night monkey) tRNA
  6. Balaenoptera acutorostrata scammoni tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  7. Balaenoptera musculus (Blue whale) tRNA
  8. Balaenoptera physalus (Fin whale) tRNA
  9. Bison bison bison (north american plains bison) tRNA
  10. Blattella germanica tRNA-Gln (TTG) (tRNA-Gln-TTG-5-1)
  11. Bos grunniens (domestic yak) tRNA
  12. Bos mutus Bos grunniens mutus tRNA
  13. Bos indicus tRNA
  14. Bos indicus x Bos taurus (hybrid cattle) tRNA
  15. Bos taurus tRNA-Gln (TTG) (tRNA-Gln-TTG-4 1 to 3)
  16. Callithrix jacchus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  17. Callorhinus ursinus (northern fur seal) tRNA
  18. Canis lupus dingo (dingo) tRNA
  19. Canis lupus familiaris tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  20. Capra hircus (goat) tRNA
  21. Carassius auratus (goldfish) tRNA
  22. Carlito syrichta tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  23. Castor canadensis (American beaver) tRNA
  24. Catagonus wagneri (Chacoan peccary) tRNA
  25. Cavia porcellus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  26. Sapajus apella Cebus apella (Tufted capuchin) tRNA
  27. Cebus imitator (Panamanian white-faced capuchin) tRNA
  28. Ceratotherium simum simum tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  29. Cercocebus atys (sooty mangabey) tRNA
  30. Cervus elaphus hippelaphus tRNA
  31. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  32. Chinchilla lanigera tRNA
  33. Chlorocebus sabaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1, tRNA-Gln-TTG-4-2)
  34. Choloepus hoffmanni tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  35. Chrysochloris asiatica tRNA
  36. Cnephaeus nilssonii tRNA-Gln
  37. Colobus angolensis palliatus tRNA
  38. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  39. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  40. Cricetulus griseus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  41. Crocuta crocuta (spotted hyena) tRNA
  42. Dasypus novemcinctus tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  43. Daubentonia madagascariensis tRNA-Gln
  44. Delphinapterus leucas (beluga whale) tRNA
  45. Diceros bicornis minor tRNA
  46. Dipodomys ordii tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  47. Echinops telfairi tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1, tRNA-Gln-TTG-4-2)
  48. Enhydra lutris kenyoni tRNA
  49. Cnephaeus nilssonii Eptesicus nilssoni (northern bat) tRNA
  50. Equus asinus (ass) tRNA
  51. Equus caballus tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  52. Erinaceus europaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  53. Eschrichtius robustus (grey whale) tRNA
  54. Felis catus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  55. Fukomys damarensis (Damara mole-rat) tRNA
  56. Galemys pyrenaicus tRNA
  57. Gorilla gorilla gorilla tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  58. Heterocephalus glaber tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  59. Hipposideros armiger tRNA
  60. Ictidomys tridecemlineatus tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  61. Inia geoffrensis tRNA-Gln
  62. Ladona fulva tRNA
  63. Leptonychotes weddellii (Weddell seal) tRNA
  64. Lipotes vexillifer (Yangtze River dolphin) tRNA
  65. Loxodonta africana tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  66. Lynx canadensis (Canada lynx) tRNA
  67. Lynx pardinus (Spanish lynx) tRNA
  68. Lytechinus variegatus tRNA-Gln
  69. Macaca fascicularis (crab-eating macaque) tRNA
  70. Macaca mulatta tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  71. Macaca nemestrina (pig-tailed macaque) tRNA
  72. Mandrillus leucophaeus (drill) tRNA
  73. Marmota marmota marmota (Alpine marmot) tRNA
  74. Marmota monax tRNA
  75. Mesocricetus auratus (golden hamster) tRNA
  76. Microcebus murinus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  77. Microtus ochrogaster (prairie vole) tRNA
  78. Molossus molossus (Pallas's mastiff bat) tRNA
  79. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  80. Monodon monoceros (narwhal) tRNA
  81. Moschus moschiferus (Siberian musk deer) tRNA
  82. Muntiacus reevesi (Chinese muntjac) tRNA
  83. Mus caroli tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  84. Mus musculus castaneus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  85. Mus musculus domesticus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  86. Mus musculus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  87. Mus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  88. Mus pahari tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  89. Mus spicilegus (steppe mouse) tRNA
  90. Mus spretus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  91. Mustela putorius furo tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  92. Myotis brandtii tRNA
  93. Myotis lucifugus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  94. Myotis myotis tRNA
  95. Nannospalax galili (Upper Galilee mountains blind mole rat) tRNA
  96. Neophocaena asiaeorientalis asiaeorientalis (yangtze finless porpoise) tRNA
  97. Neotoma lepida (desert woodrat) tRNA
  98. Neogale vison Neovison vison tRNA
  99. Nomascus leucogenys tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1, tRNA-Gln-TTG-4-2)
  100. Nyctereutes procyonoides (raccoon dog) tRNA
  101. Ochotona princeps tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  102. Octodon degus (degu) tRNA
  103. Odobenus rosmarus divergens (Pacific walrus) tRNA
  104. Odocoileus virginianus texanus tRNA
  105. Orycteropus afer afer tRNA
  106. Oryctolagus cuniculus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  107. Otolemur garnettii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  108. Ovis aries tRNA-Gln (TTG) (tRNA-Gln-TTG-5 1 to 3)
  109. Pan paniscus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  110. Panthera leo (lion) tRNA
  111. Panthera tigris altaica (Amur tiger) tRNA
  112. Pan troglodytes tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  113. Papio anubis tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  114. Peromyscus maniculatus bairdii (prairie deer mouse) tRNA
  115. Peromyscus maniculatus sonoriensis tRNA-Gln
  116. Phocoena sinus (vaquita) tRNA
  117. Physeter macrocephalus Physeter catodon (sperm whale) tRNA
  118. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  119. Pipistrellus kuhlii (Kuhl's pipistrelle) tRNA
  120. Plecturocebus cupreus tRNA-OTHER
  121. Pocillopora damicornis tRNA-Gln
  122. Pongo abelii tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  123. Procavia capensis tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  124. Prolemur simus (greater bamboo lemur) tRNA
  125. Propithecus coquereli (Coquerel's sifaka) tRNA
  126. Pteropus alecto (black flying fox) tRNA
  127. Puma concolor (puma) tRNA
  128. Rattus norvegicus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  129. Rhinolophus ferrumequinum (greater horseshoe bat) tRNA
  130. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  131. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  132. Rousettus aegyptiacus (Egyptian rousette) tRNA
  133. Saimiri boliviensis boliviensis tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
  134. Sciurus carolinensis (gray squirrel) tRNA
  135. Sciurus vulgaris (Eurasian red squirrel) tRNA
  136. Sigmodon hispidus tRNA-Gln
  137. Sorex araneus tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  138. Sousa chinensis (Indo-pacific humpbacked dolphin) tRNA
  139. Spermophilus dauricus (Daurian ground squirrel) tRNA
  140. Urocitellus parryii Spermophilus parryii (Arctic ground squirrel) tRNA
  141. Stegodyphus mimosarum tRNA-Gln for anticodon UUG
  142. Suricata suricatta (meerkat) tRNA
  143. Sus scrofa tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  144. Symphalangus syndactylus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  145. Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA
  146. Theropithecus gelada (gelada baboon) tRNA
  147. Trichechus manatus latirostris tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  148. Tupaia belangeri chinensis Tupaia chinensis (Chinese tree shrew) tRNA
  149. Tursiops truncatus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  150. Ursus americanus (American black bear) tRNA
  151. Ursus maritimus (polar bear) tRNA
  152. Vicugna pacos tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
  153. Vulpes vulpes (red fox) tRNA
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications