Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saimiri boliviensis boliviensis tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1) secondary structure diagram

Saimiri boliviensis boliviensis tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1) URS00002901EC_39432

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 61 other species

  1. Ailuropoda melanoleuca tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  2. Balaenoptera acutorostrata scammoni tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  3. Blattella germanica tRNA-Gln (TTG) (tRNA-Gln-TTG-5-1)
  4. Bos taurus tRNA-Gln (TTG) (tRNA-Gln-TTG-4 1 to 3)
  5. Callithrix jacchus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  6. Canis lupus familiaris tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  7. Carlito syrichta tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  8. Cavia porcellus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  9. Ceratotherium simum simum tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  10. Chlorocebus sabaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1, tRNA-Gln-TTG-4-2)
  11. Choloepus hoffmanni tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  12. Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  13. Cricetulus griseus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  14. Dasypus novemcinctus tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  15. Dipodomys ordii tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  16. Echinops telfairi tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1, tRNA-Gln-TTG-4-2)
  17. Eptesicus nilssonii tRNA-Gln
  18. Equus caballus tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  19. Erinaceus europaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  20. Felis catus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  21. Fukomys damarensis (Damara mole-rat) tRNA
  22. Gorilla gorilla gorilla tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  23. Heterocephalus glaber tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  24. Homo sapiens tRNA-Gln (anticodon TTG) 3-1 (TRQ-TTG3 1 to 3)
  25. Ictidomys tridecemlineatus tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  26. Loxodonta africana tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  27. Lytechinus variegatus (Green sea urchin) tRNA-Gln
  28. Macaca mulatta tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  29. Marmota monax tRNA.Gln
  30. Mesocricetus auratus tRNA
  31. Microcebus murinus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  32. Mus caroli tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  33. Mus musculus castaneus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  34. Mus musculus domesticus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  35. Mus musculus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  36. Mus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  37. Mus pahari tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  38. Mus spretus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  39. Mustela putorius furo tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  40. Myotis brandtii tRNA
  41. Myotis lucifugus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  42. Neotoma lepida (desert woodrat) tRNA
  43. Nomascus leucogenys tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1, tRNA-Gln-TTG-4-2)
  44. Ochotona princeps tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  45. Oryctolagus cuniculus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  46. Otolemur garnettii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  47. Ovis aries tRNA-Gln (TTG) (tRNA-Gln-TTG-5 1 to 3)
  48. Pan troglodytes tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  49. Papio anubis tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  50. Pocillopora damicornis (Cauliflower coral) tRNA-Gln
  51. Pongo abelii tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  52. Procavia capensis tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  53. Pteropus alecto tRNA
  54. Rattus norvegicus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  55. Sorex araneus tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  56. Stegodyphus mimosarum tRNA-Gln for anticodon UUG
  57. Sus scrofa tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  58. Trichechus manatus latirostris tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  59. Tupaia chinensis (Chinese tree shrew) tRNA
  60. Tursiops truncatus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  61. Vicugna pacos tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
2D structure Publications