Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Callithrix jacchus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1) secondary structure diagram

Callithrix jacchus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1) URS00002901EC_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 61 other species

  1. Ailuropoda melanoleuca tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  2. Balaenoptera acutorostrata scammoni tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  3. Blattella germanica tRNA-Gln (TTG) (tRNA-Gln-TTG-5-1)
  4. Bos taurus tRNA-Gln (TTG) (tRNA-Gln-TTG-4 1 to 3)
  5. Canis lupus familiaris tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  6. Carlito syrichta tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  7. Cavia porcellus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  8. Ceratotherium simum simum tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  9. Chlorocebus sabaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1, tRNA-Gln-TTG-4-2)
  10. Choloepus hoffmanni tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  11. Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  12. Cricetulus griseus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  13. Dasypus novemcinctus tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  14. Dipodomys ordii tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  15. Echinops telfairi tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1, tRNA-Gln-TTG-4-2)
  16. Eptesicus nilssonii tRNA-Gln
  17. Equus caballus tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  18. Erinaceus europaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  19. Felis catus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  20. Fukomys damarensis (Damara mole-rat) tRNA
  21. Gorilla gorilla gorilla tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  22. Heterocephalus glaber tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  23. Homo sapiens tRNA-Gln (anticodon TTG) 3-1 (TRQ-TTG3 1 to 3)
  24. Ictidomys tridecemlineatus tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  25. Loxodonta africana tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  26. Lytechinus variegatus (Green sea urchin) tRNA-Gln
  27. Macaca mulatta tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  28. Marmota monax tRNA.Gln
  29. Mesocricetus auratus tRNA
  30. Microcebus murinus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  31. Mus caroli tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  32. Mus musculus castaneus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  33. Mus musculus domesticus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  34. Mus musculus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  35. Mus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  36. Mus pahari tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  37. Mus spretus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  38. Mustela putorius furo tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  39. Myotis brandtii tRNA
  40. Myotis lucifugus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  41. Neotoma lepida (desert woodrat) tRNA
  42. Nomascus leucogenys tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1, tRNA-Gln-TTG-4-2)
  43. Ochotona princeps tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  44. Oryctolagus cuniculus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  45. Otolemur garnettii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  46. Ovis aries tRNA-Gln (TTG) (tRNA-Gln-TTG-5 1 to 3)
  47. Pan troglodytes tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  48. Papio anubis tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  49. Pocillopora damicornis (Cauliflower coral) tRNA-Gln
  50. Pongo abelii tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  51. Procavia capensis tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  52. Pteropus alecto tRNA
  53. Rattus norvegicus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  54. Saimiri boliviensis boliviensis tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
  55. Sorex araneus tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  56. Stegodyphus mimosarum tRNA-Gln for anticodon UUG
  57. Sus scrofa tRNA-Gln (TTG) (tRNA-Gln-TTG-3 1 to 3)
  58. Trichechus manatus latirostris tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 3)
  59. Tupaia chinensis (Chinese tree shrew) tRNA
  60. Tursiops truncatus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  61. Vicugna pacos tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
2D structure Publications