v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Oryctolagus cuniculus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2) secondary structure diagram

Oryctolagus cuniculus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2) URS00001F9D54_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GACCACGUGGCCUAAUGGAUAAGGCGUCUGACUUCGGAUCAGAAGAUUGAGGGUUCGAAUCCCUUCGUGGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 58 other species

  1. Ailuropoda melanoleuca tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  2. Balaenoptera acutorostrata scammoni tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  3. Bos taurus tRNA-Arg (TCG) (tRNA-Arg-TCG-4 1 to 3)
  4. Callithrix jacchus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  5. Camelus ferus (Wild Bactrian camel) tRNA
  6. Canis lupus familiaris tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  7. Carlito syrichta tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  8. Cavia porcellus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  9. Ceratotherium simum simum tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  10. Chlorocebus sabaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  11. Choloepus hoffmanni tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  12. Cricetulus griseus tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  13. Dasypus novemcinctus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  14. Dipodomys ordii tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  15. Echinops telfairi tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  16. Eptesicus nilssonii tRNA-Arg
  17. Equus caballus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  18. Erinaceus europaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  19. Felis catus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  20. Fukomys damarensis (Damara mole-rat) tRNA
  21. Gorilla gorilla gorilla tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  22. Heterocephalus glaber tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  23. Homo sapiens tRNA-Arg (anticodon TCG) 5-1 (TRR-TCG5-1)
  24. Ictidomys tridecemlineatus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  25. Loxodonta africana tRNA-Arg (TCG) (tRNA-Arg-TCG-3 1 to 3)
  26. Macaca mulatta tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1)
  27. Marmota monax (woodchuck) tRNA.Arg
  28. Mesocricetus auratus (golden hamster) tRNA
  29. Microcebus murinus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  30. Monodelphis domestica tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  31. Mus caroli tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  32. Mus musculus castaneus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  33. Mus musculus domesticus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  34. Mus musculus musculus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  35. Mus musculus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  36. Mus pahari tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  37. Mus spretus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  38. Mustela putorius furo tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1, tRNA-Arg-TCG-4-2)
  39. Myotis brandtii tRNA
  40. Myotis lucifugus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  41. Neotoma lepida (desert woodrat) tRNA
  42. Notamacropus eugenii tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  43. Ochotona princeps tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  44. Otolemur garnettii tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  45. Ovis aries tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1, tRNA-Arg-TCG-5-2)
  46. Pan troglodytes tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1)
  47. Papio anubis tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1)
  48. Pongo abelii tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  49. Procavia capensis tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  50. Pteropus alecto (black flying fox) tRNA
  51. Rattus norvegicus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  52. Saimiri boliviensis boliviensis tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  53. Sarcophilus harrisii tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  54. Sus scrofa tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  55. Trichechus manatus latirostris tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  56. Tupaia chinensis tRNA
  57. Tursiops truncatus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  58. Vicugna pacos tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
 2D structure Publications