Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Callithrix jacchus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1) secondary structure diagram

Callithrix jacchus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1) URS00001F9D54_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCACGUGGCCUAAUGGAUAAGGCGUCUGACUUCGGAUCAGAAGAUUGAGGGUUCGAAUCCCUUCGUGGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 58 other species

  1. Ailuropoda melanoleuca tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  2. Balaenoptera acutorostrata scammoni tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  3. Bos taurus tRNA-Arg (TCG) (tRNA-Arg-TCG-4 1 to 3)
  4. Camelus ferus (Wild Bactrian camel) tRNA
  5. Canis lupus familiaris tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  6. Carlito syrichta tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  7. Cavia porcellus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  8. Ceratotherium simum simum tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  9. Chlorocebus sabaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  10. Choloepus hoffmanni tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  11. Cricetulus griseus tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  12. Dasypus novemcinctus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  13. Dipodomys ordii tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  14. Echinops telfairi tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  15. Eptesicus nilssonii tRNA-Arg
  16. Equus caballus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  17. Erinaceus europaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  18. Felis catus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  19. Fukomys damarensis (Damara mole-rat) tRNA
  20. Gorilla gorilla gorilla tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  21. Heterocephalus glaber tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  22. Homo sapiens tRNA-Arg (anticodon TCG) 5-1 (TRR-TCG5-1)
  23. Ictidomys tridecemlineatus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  24. Loxodonta africana tRNA-Arg (TCG) (tRNA-Arg-TCG-3 1 to 3)
  25. Macaca mulatta tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1)
  26. Marmota monax (woodchuck) tRNA.Arg
  27. Mesocricetus auratus (golden hamster) tRNA
  28. Microcebus murinus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  29. Monodelphis domestica tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  30. Mus caroli tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  31. Mus musculus castaneus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  32. Mus musculus domesticus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  33. Mus musculus musculus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  34. Mus musculus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  35. Mus pahari tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  36. Mus spretus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  37. Mustela putorius furo tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1, tRNA-Arg-TCG-4-2)
  38. Myotis brandtii tRNA
  39. Myotis lucifugus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  40. Neotoma lepida (desert woodrat) tRNA
  41. Notamacropus eugenii tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  42. Ochotona princeps tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  43. Oryctolagus cuniculus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  44. Otolemur garnettii tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  45. Ovis aries tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1, tRNA-Arg-TCG-5-2)
  46. Pan troglodytes tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1)
  47. Papio anubis tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1)
  48. Pongo abelii tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  49. Procavia capensis tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  50. Pteropus alecto (black flying fox) tRNA
  51. Rattus norvegicus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  52. Saimiri boliviensis boliviensis tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  53. Sarcophilus harrisii tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  54. Sus scrofa tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
  55. Trichechus manatus latirostris tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  56. Tupaia chinensis tRNA
  57. Tursiops truncatus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  58. Vicugna pacos tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-3-2)
2D structure Publications